![]() |
GeneWalker manual pages The manual pages will be updated continuously. Please send a mail to genewalker@cybergene.se to let us know if you have any comments or suggestions for how to improve GeneWalker. |
Using this help
System requirements
Principles for primer design
GeneWalker basic functions
Commands
Format
Clear all
Clear results
Clear target
Clear primer 1
Clear primer 2
Rev compl 1
Rev compl 2
2:ary struct 1
2:ary struct 2
Anneal 1
Anneal 2
Primer dimers
Sequence
Order oligo
Help
Importing sequences
Ordering oligo
Options
Support
FAQ
This manual assumes that you are familiar with the use of the WWW and using a web browser such as Netscape Communicator or Microsoft Internet Explorer. If you are not familiar with basic operations of your web browser, then you are strongly advised to take some time and browse through a tutorial, either at Microsoft or check out the Help contents in your Netscape Communicator.
The on-line manual is opened by clicking on the Help button. The manual is always opened in a separate browser window. This allows you to accesses the manual without interrupting your work. As an alternative, the manual can also be accessed direct from your web browser at the URL http://www.cybergene.se/primerdesign/help.html.
The manual contains an index containing all help topics. Each topic can be reached simply by clicking the index entry. You can always quickly reach the index through the link at the end of each topic.
Back to index.
There are no additional systems requirements except those stated from the supplier of your web browser. However, your web browser must be Java enabled. The browser must support Java JDK 1.1 or higher. Currently this JDK version is handled both by Microsoft Internet Explorer 4 and Netscape Communicator 4.06 or higher.
Since alignments are computationally resource consuming you may prefer to use reasonable modern computer with a quick processor. Except for this there are no requirements on the make of computer, any PC, Mac or UNIX workstation will do, neither are there any requirements of hard disk space. If you have a machine with a modern web browser then you are all set.
Your computer also need a network connection. GeneWalker does not place any bandwidth requirements. However, when you start GeneWalker there is a download of Java bite code to your computer. The download is quite small (roughly 20 kb) so even a slow network connection will not cause elongated downloading times.
Back to index.
Please refer to the standard literature [J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, Second Edition]. This part of the manual will be elaborated in the final version of GeneWalker.
Back to index.
The annealing and primer dimer function is based on a full implementation of the Smith Waterman algorithm [Smith T.F. and Waterman M.S., 1981, Comparison of biosequences, Adv. in Applied Mathematics 2:482-489 and Smith T.F. and Waterman M.S., 1981, Identification of common molecular subsequences, J. Mol. Biol. 147:195-197]. The default parameters are as follows:
Score for match is 1, and for miss-match -1/3
Gap opening penalty is 1 + k*1/3 where k is the gap length
The secondary structure analysis is based on a modified Smith Waterman algorithm where gap insertion is disallowed. The analysis does not consider pseudo knots. The implementation of GeneWalker allows primers with a maximum length of 200 bp and target sequences with a maximum length of 2000 bp.
The primer sequences can be transformed into their complementary sequence, which is presented reversed. Repeating this function twice produces the original primer sequence.
The formatting function arranges the sequences nucleotides into groups of 10 and removes superfluous blanks and digits. All input and result fields can be cleared selectively or all at once. It is recommended to use the Clear result function before a new analysis is performed.
Back to index.
GeneWalker allows you to execute a number of commands simply by pressing a button. All available commands are listed in table 1.
| Formatting commands: | Sequence related commands: | Other commands: |
| Format | Rev compl 1 | Sequence |
| Clear all | Rev compl 2 | Order oligo |
| Clear results | 2:ary struct 1 | Help |
| Clear target | 2:ary struct 2 | |
| Clear primer 1 | Anneal 1 | |
| Clear primer 2 | Anneal 2 | |
| Primer dimers |
Below follows a detailed description of each command listed above.
Back to index.
This command removes superfluous blanks and digits from the sequence and groups the base nucleotides into groups of 10. Invoking Format will format all input field, that is, target sequence and the two primer fields.
Back to index.
Clears all input and result fields. Currently there is no undo function.
Back to index.
Clears all result fields. Currently there is no undo function.
Back to index.
Clears the target sequence input field. Currently there is no undo function.
Back to index.
Clears the primer sequence input field. Clear primer 1 clears the field for primer 1 and vice versa for Clear primer 2. Currently there is no undo function.
Back to index.
Complements and reverses the sequence in the primer sequence input field. Rev comp1 performs the function in the primer 1 field and vice versa for Rev comp1. The result is presented formatted. To undo simply invoke the function again.
Back to index.
Displays the primer's secondary structure. 2:ary struct 1 performs the function for primer 1 and vice versa for 2:ary struct 2. The secondary structure is calculated through an alignment based on a modified version of Smith Waterman's algorithm disallowing gap insertions.
The 10 most likely secondary structures are displayed in descending order of likelihood. The structures are calculated using a modified Smith Waterman alignment not allowing for gap insertions. Pseudo knots are not considered. The structure is displayed using a notation where square brackets "[" and "]" indicates binding regions. GeneWalker do not produce a graphical display of the actual structure. Users who need to get a graphical display are recommended to import the output from GeneWalker into a program dedicated for the display of structures - for example loopDloop. The order of likelihood does not take any thermo dynamical calculations into account, the likelihood is purely based on the score calculated in the Smith Waterman algorithm.
Primer 2:ary structures are displayed as follows: Given the primer sequence
AAAAACCCCCAAAGGGGGAAAAAAA
The obvious hairpin structure
A
A A
C-G
C-G
C-G
C-G
AAAAA AAAAAAA
is displayed as
AAAAA[CCCCC]AAA[GGGGG]AAAAAAA
Thus, by pairing subsequences enclosed by square brackets, a rudimentary picture of the 2:ary can be constructed.
In the Message output field information about the primer is displayed. The information given is: length, G/C content, annealing and melting temperatures. In addition there are warning and information messages displayed in this field as well. The example sequence above generates, for example, the following information in the message field.
Primer length = 25
G/C ratio = 40.0%
T(m) = 61.6
T(a) = 56.6
The value for T(m) and T(a) are calculated according to the following formulae [J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, Second Edition, p 11.46] in table 2. For a detailed discussion on conditions for hybridization of oligonucleotide probes please refer to Maniatis handbook on molecular cloning [J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, Second Edition, pp 11.45-11.57].
Table 2: Formulae for calculating T(m) and T(a)
| T(m) = 81.5 +16.6(log(Na+)) + 0.41(G/C ratio) - 600/N |
| T(a) = T(m) - 5 |
| where N = chain lenghts. This formulae is valid for (Na+) £ 1M and when 14 £ N £ 70 |
Back to index.
Anneal 1 displays the local alignment between the target sequence and primer 1 and vice versa for Anneal 2. The alignment is calculated with a full implementation of Smith Waterman's algorithm.

Back to index.
Back to index.
Back to index.
Back to index.
The Sequence button opens up a new browser window and connects to the SRS tool at EBI. This allows you to retrieve sequences at your convenience and copy them into GeneWalker for further processing.
Back to index.
The Order oligo button opens up a new browser window and connects to CyberGene's web-pages for ordering oligonucleotide synthesis. This is a convenient way to order your primers, you can simply copy them from GeneWalker into the order form.
Back to index.
This function will be included in the final production release of GeneWalker.
Back to index.
Basic support is given to all licensed users of GeneWalker during office hours (10 - 16 European Standard Time)
phone support
E-mail genewalker@cybergene.se are usually responded to within the
following working day.
Back to index.
Back to index.